• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    USE OF RECEIVER SIMILAR TO TOLL AGONIST FOR CANCER TREATMENT. The present invention is directed to methods and agents used to treat cancer or infectious diseases by providing a toll-like receptor as a toll-like receptor 5 (TLR-5) in combination with the provision of a toll-like receptor agonist such as flagelin resulting in a cis and trans effect that recruits cells involved in both innate (cis effect) and adaptive (trans effect) immune responses to specifically kill cancer cells infected with a pathogen, via the NF-kB apoptosis pathway.
    公开号:BR112012011331B1
    申请号:R112012011331-3
    申请日:2010-10-06
    公开日:2021-03-02
    发明作者:Andrei V. Gudkov
    申请人:Roswell Park Cancer Institute；Panacela Labs Llc；
    IPC主号:
    专利说明:

    FIELD OF THE INVENTION
    [0001] This invention relates to methods of treating cancer and infectious diseases. BACKGROUND OF THE INVENTION
    [0002] Toll-like receptors are responsible for recognizing the most common models of bacterial and viral pathogens. Its activation results in the recruitment of an innate and subsequently adaptive immune response. Receptor cells of the immune system at the site of the presence of antigens is the key step in the effective immune response. This is because immunization involves the use of different types of adjuvants. Although most tumors express tumor-specific antigens, they are using a number of mechanisms that then allow immune recognition to escape. It has recently been demonstrated in mouse models that the activation of TLR5 by its ligand and agonist, bacterial flagellin, results in the induction of an antitumor effect against those tumors that express functional TLR5. This opens up a general opportunity to consider TLR5 agonists for cancer immunotherapy. There are two major obstacles in the way of reducing this idea in practice. First, it is the rare incidence of tumors that express functional TLR5, limiting the applicability of this approach to only a small subset of tumors. Second, systemic administration of TLR5 agonist leads to activation of TRL5 signaling in all cells that have a functional receptor that produces non-focused response and non-specific tumor. Consequently, there is a need in the art for a mechanism or method for autocrine TLR receptor activation that signals in infected or tumor cells with minimal systemic effect, thereby enabling it to attract innate immune response specifically to the infected cell or tumor. SUMMARY OF THE INVENTION
    [0003] The present invention can be directed to a vector comprising first and second nucleic acids, wherein the first nucleic acid encodes a toll-like receptor, and the second nucleic acid encodes a toll-like agonist. The first nucleic acid can encode a secreted form of a toll-like receptor. The second nucleic acid can be a secreted form of flagellin. The toll-like receptor agonist may be flagellin. The vector can be a mammalian expression vector. The vector can be expressed as an adenovirus, a lentivirus, or a liposome. The secreted form of flagellin can be CBLB502S. The toll-like receiver can be TLR-5.
    [0004] The present invention can be used for the treatment of cancer in a mammal comprising administering to a mammal in need thereof an agent comprising the vector comprising first and second nucleic acids, wherein the first nucleic acid encodes a toll-like receptor, and the second nucleic acid encodes a toll-like receptor agonist. Cancer can be a tumor. The tumor can be derived from the group consisting of prostate, breast, colon, esophagus, stomach, lung, pancreatic, renal, thyroid, ovaries, throat, or cervix. The tumor can be derived from the group consisting of sarcomas, melanomas, leukemias, and lymphomas. The agent can be administered in trans or outside the mammalian tumor. The agent can be administered directly to a mammalian tumor. The agent can be administered in combination with an immunostimulant. The immunostimulant can be selected from the group consisting of growth hormone, prolactin and vitamin D. The growth hormone can be somatotrophin. The agent can be administered in combination with a cytokine. The cytokine can be a stem cell factor.
    [0005] The present invention can also be used for the treatment of an infection in a mammal comprising administering to a mammal in need thereof the agent comprising the vector comprising first and second nucleic acids, wherein the first nucleic acid encodes a toll-like receptor. , and the second nucleic acid encodes a toll-like receptor agonist. Cancer can be a tumor. The infection can be derived from the group consisting of viruses, bacteria, protozoan parasites, and fungi. BRIEF DESCRIPTION OF THE DRAWINGS
    [0006] Figure 1A-1C represents schematic maps of adenoviral vectors that express TLR5, CBLB502S and their combination (TLR5 + CBLB502S).
    [0007] Figure 2 represents the results of the proportion of mouse tumor volume over a number of days in tumor cells (A549) transduced with a control vector (without TLR5) or vector expressing TLR5 in which the mice are treated three days with either CBLB502 or PBS.
    [0008] Figure 3 represents the suppression of tumor growth by injection of adenovirus comprising a vector that coexpresses CBLB502S and a toll-like receptor in which adenovirus is injected into the colon cancer carcinoma tumor of CT26 mice and study of cis and trans effects of mice adenoviral vector constructs.
    [0009] Figure 4 shows the domain structure of bacterial flagellin. The Ca support trace, hydrophobic core distribution and F41 structural information. Four distinct hydrophobic nuclei that define domains D1, D2a, D2b and D3. All hydrophobic side-chain atoms are revealed with the support of Ca. The side-chain atoms are color-coded: Ala, yellow; Leu, Ile or Val, orange; Phe and Tyr, purple (carbon atoms) and red (oxygen atoms). c, Position and region of various structural features in the flagellin amino acid sequence. Shown are, from top to bottom: the F41 fragment in blue; three times b-folium in brown; the distribution of secondary structure with a-helix in yellow, b-structure in green, and b-gyrus in purple; tic mark on all 50 residues in blue; domains D0, D1, D2 and D3; the axial subunit contact region within the cyan protoelement; the well-preserved amino acid sequence in red and the variable region in violet; point mutations in F41 that produces the elements of different superspires. Letters at the bottom indicate the morphology of mutant elements: L (D107E, R124A, R124S, G426A), L-type straight; R (A449V), R- straight type; C (D313Y, A414V, A427V, N433D), curly33.
    [00010] Figure 5 shows a scheme of Salmonella flagelina domains, their fragments, and their interaction with TLR5. Dark bars denote regions of the flagellin gene used to construct fragments comprising A, B, C, A 'and B'.
    [00011] Figure 6 represents derivatives of flagellin. The domain structure and approximate limits (amino acid coordinates) of selected flagellin derivatives (listed on the right). FliC flagellin from Salmonella dublin is encoded within 505 amino acids (aa).
    [00012] Figure 7 shows the nucleotide and amino acid sequence for the following flagellin variants: AA '(SEQ ID NO: 7-8), AB' (SEQ ID NO: 9-10), BA '(SEQ ID NO : 11-12), BB '(SEQ ID NO: 13-14), CA' (SEQ ID NO: 15-16), CB '(SEQ ID NO: 17-18), A (SEQ ID NO: 1920) , B (SEQ ID NO: 21-22), C (SEQ ID NO: 23-24), GST-A '(SEQ ID NO: 25-26), GST-B' (SEQ ID NO: 27-28) , AA'n1-170 (SEQ ID NO: 29-30), AA'n1-163 (SEQ ID NO: 33-34), AA'n54-170 (SEQ ID NO: 31-32), AA'n54- 163 (SEQ ID NO: 335-36), AB'n1-170 (SEQ ID NO: 37-38), AB'n1-163 (SEQ ID NO: 39-40), AA'n1-129 (SEQ ID NO : 41-42), AA'n54-129 (SEQ ID NO: 43-44), AB'n1-129 (SEQ ID NO: 45-46), AB'n54-129 (SEQ ID NO: 47-48) , AA'n1-100 (SEQ ID NO: 49-50), AB'n1-100 (SEQ ID NO: 51-52), AA'n1-70 (SEQ ID NO: 53-54) and AB'n1- 70 (SEQ ID NO: 55-56). The conductive sequence pRSETb is shown in Italics (conductor includes Met, which is also amino acid 1 of FliC). The N terminal constant domain is underlined. The amino acid linker sequence is in bold. The C terminal constant domain is underlined. GST, if present, is highlighted.
    [00013] Figure 8 shows a comparison of amino acid sequences of the conserved amino (figure 8A) and carboxy (figure 8B) terminal of 21 species of bacteria. The 13 conserved amino acids important for TLR5 activity are shown with shading. Amino acid sequences are identified by their TrEMBL (first letter = Q) or Swiss-Prot (first letter = P) accession numbers.
    [00014] Figure 9 shows the nucleic acid and amino acid sequence for the human toll protein type 5 receptor. DETAILED DESCRIPTION
    [00015] The inventors made the surprising discovery that the provision of a toll-like receptor, such as a toll-like receptor 5 (TLR-5), in combination with a toll-like receptor agonist, such as flagellin, results in a cis and trans effect which recruits cells involved in both the innate immune response (cis effect) and adaptive (trans effect to specifically kill cancer cells and cells infected with a pathogen, via the NF-KB apoptosis pathway. While not being bound by theory, the idea implemented in this invention was (i) to overcome the dependence on TLR-mediated immunization strategies in expression of pre-existing TLR in a tumor by tumor transduction with a TLR construct trigger expression; and (ii) to direct the response immune to the tumor by creating a local TLR agonist pool. For example, drug formulations comprising TLR simultaneously induce expression and activate TLR, thereby exposing tumor cells to the immune system of the tumor. spedeiro imitating the situation of massive bacterial penetration through the intestinal wall.
    [00016] By providing a TLR such as TLR5, and a TLR agonist such as flagellin, to interact and activate both the innate and adaptive immune systems, the method can be used to treat tumors derived from prostate, breast, colon cancer , esophagus, stomach, lung, pancreatic, renal, thyroid, ovaries, throat, or cervix, as well as treating sarcomas, melanomas, leukemias, and lymphomas. The applications of this method are not limited to cancer treatments, as this method can also be used to treat infections derived from viruses, bacteria, protozoan parasites and fungi.
    [00017] Variations in TLR and TLR agonist provision may include vectors, TLR receptor coexpression and a secretible form of flagellin that activates TLR activity in the same compromised mammalian cell. The method of the present invention can also include vector constructs that express the TLR receptor in a mammalian cell and the TLR agonist being trans-administered to the cell. For example, an adenoviral vector may require modification of flagellin to achieve its effective synthesis and secretion by mammalian cells. 1. Definitions.
    [00018] The terminology used here is for the proposal to describe particular embodiments only, and is not intended to be limiting. As used in the specification and the appended claims, the singular forms "one", "one" and "o" include plural referents, unless the context otherwise determines clearly.
    [00019] For the determination of numerical ranges here, each intervention number here within the same degree of precision is explicitly contemplated. For example, for the 6-9 range, numbers 7 and 8 are included in addition to 6 and 9, and for the 6.0-7.0 range, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7 , 6.8, 6.9, and 7.0 are explicitly contemplated.
    [00020] "Administer" may mean a single dose or multiple doses of an agent or agents.
    [00021] "Analog" can mean, in the context of a peptide or polypeptide, a peptide or polypeptide comprising one or more untwisted amino acids or other structural variations from the conventional set of amino acids.
    [00022] "Antibody" can mean an antibody of classes IgG, IgM, IgA, IgD or IgE, or fragments, or derivatives thereof, including Fab, F (ab ') 2, Fd, and single chain antibodies, diabody, antibodies bispecific, bifunctional antibodies and derivatives thereof. The antibody can be a monoclonal antibody, polyclonal antibody, purified affinity antibody, or mixtures thereof, which exhibit sufficient binding specificity to a desired epitope or a sequence derived therefrom. The antibody can also be a chimeric antibody. The antibody can be derivatized by fixing one or more portions of a chemical, peptide, or polypeptide known in the art. The antibody can be conjugated to a chemical moiety.
    [00023] A "derivative" can mean a different peptide or polypeptide in the primary structure (amino acids and amino acid analogs). Derivatives may differ because they are glycosylated, a form of post-translational modification. For example, peptides or polypeptides can exhibit glycosylation models due to expression in heterologous systems. If at least one biological activity is retained, then these peptides or polypeptides are derived according to the invention. Other derivatives may include fusion peptides or fusion polypeptides having a covalently modified N- or C-terminal, PEGylated peptides or polypeptides, peptides or polypeptides associated with portions of lipid, alkylated peptides or polypeptides, articulated peptides or polypeptides, via a functional group side chain amino acid for other peptides, polypeptides or chemicals, and additional modifications as would be understood in the art.
    [00024] A "fragment" can mean a portion of a reference peptide or polypeptide.
    [00025] A "homologue" can mean a peptide or polypeptide that shares a common evolutionary ancestor.
    [00026] A "conducting sequence" can be a nucleic acid that encodes any peptide sequence that is articulated and translated with a peptide or polypeptide of interest to allow the peptide or polypeptide of interest to be correctly targeted through a cell endoplasmic reticulum eukaryotic and Golgi complexes for the proposal of extracellular secretion from the cell membrane. The conductive peptide sequence can be derived from alkaline phosphatase. The conductor sequence can have a DNA sequence comprising atgctgctgctgctgctgctgctgggcctgaggctacagctct ccctgggc.
    [00027] A "liposome" can mean a small bubble (vesicle) produced from the same material as a cell membrane. A liposome will be filled with drugs and used to distribute drugs for cancer and other diseases. A liposome can be filled with a vector. A liposome membrane can be produced from phospholipids, which are molecules that have a head group and a tail group. The head of the liposome can be attracted to water, and the tail, which is produced from a long hydrocarbon chain, is repelled by water. Tails can be repelled by water, and line up to form a surface out of the water. The lipids in the plasma membrane can be mainly phospholipids similar to phosphatidylethanolamine and phosphatidylcholine. Liposomes can be composed of naturally derived phospholipids with mixed lipid chains (similar to egg phosphatidylethanolamine), or pure surfactant components similar to DOPE (dioleoylphosphatidylethanolamine).
    [00028] A "peptide" or "polypeptide" can mean an articulated sequence of amino acids, and can be natural, synthetic, or a modification or combination of natural and synthetic.
    [00029] "Substantially identical" can mean that a first and second amino acid sequences are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% over a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100 amino acids.
    [00030] "Treating", "treating" or "treating" each can mean alleviating, suppressing, suppressing, eliminating, preventing or decreasing the appearance of symptoms, clinical signs, or underlying pathology of a condition or disorder on a temporary or permanent basis . Prevention of a condition or disorder involves administering an agent of the present invention to an individual prior to the onset of the disease. Suppressing a condition or disorder involves administering an agent of the present invention to an individual after inducing the condition or disorder, but before its clinical appearance. Suppressing the condition or disorder involves administering an agent of the present invention to an individual after the clinical onset of the disease.
    [00031] A "variant" can mean a peptide or polypeptide that differs in sequence from amino acid by insertion, deletion or conservative substitution of amino acids, but retains at least one biological activity. Representative examples of "biological activity" include the ability to bind to a toll-like receptor and to be bound by a specific antibody. Variant can also mean a protein with an amino acid sequence that is substantially identical to a protein referenced with an amino acid sequence that retains at least one biological activity. A conservative substitution of an amino acid, that is, replacement of an amino acid with a different amino acid with similar properties (for example, hydrophilicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes can be identified, in part, by considering the hydropathic index of amino acids, as understood in the art. Kyte et al., J. Mol. Biol. 157: 105-132 (1982). The hypocratic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hypocratic indexes can be substituted and still retain protein function. In one respect, amino acids having hypocratic indices of ± 2 are replaced. The hydrophilicity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide allows the calculation of the average local hydrophilicity greater than that peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity. United States Patent No. 4,554,101, incorporated herein in its entirety by reference. The substitution of amino acids having similar hydrophilicity values can result in peptides that retain biological activity, for example, immunogenicity, as is understood in the art. Substitutions can be made with amino acids having hydrophilicity values within ± 2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by hydrophobicity, hydrophilicity, charge, size and other properties.
    [00032] A "vector" can mean a nucleic acid sequence containing an origin of replication. A vector can be a plasmid, a yeast or an artificial mammal chromosome. A vector can be an RNA or DNA vector. A vector can be either a self-replicating extrachromosomal vector or a vector that integrates with a host genome. 2. Toll-type receiver
    [00033] Provided here is a toll-type receiver (TLR), which can be a type of model recognition receiver (PRR). TLR can recognize molecules that are conserved molecule products derived from pathogens that include Gram-positive, Gram-negative bacteria, fungi, and viruses, but are distinguishable from host molecules, collectively referred to as molecular models associated with pathogenesis (PAMPs). TLR can also recognize endogenous molecules released from damaged or dye cells, collectively referred to as the damage-associated molecular model (DAMPs). A PAMP or DAMP can be a TLR agonist as further described below. The TLR can be a fragment, variant, analog, homologous or derivative that recruits adapter molecules within the cell cytoplasm in order to propagate a signal. The TLR can be of a human species or another species of mammal such as a rhesus monkey, mouse or rat. The TLR can be at least 30-99% identical to a TLR that recruits adapter molecules within the cell cytoplasm in order to propagate a signal.
    [00034] The TLR may be one of between ten and fifteen types of TLR that are estimated to exist in many species of mammals. The TLR may be one of 13 TLRs (simply called TLR1 to TLR13) that have been identified in humans and mice together, or they may be an equivalent form that has been found in other species of mammals. The TLR may be one of 11 members (TLR1-TLR11) that have been identified in humans.
    [00035] TLR can be expressed by different types of immune cells, and can be located on the cell surface or in the cell's cytoplasm. TLR can be expressed in cancer cells. TLR can be expressed by normal epithelial cells in the digestive system, normal keratinocytes in the skin, alveolar and bronchial epithelial cells, and epithelial cells in the female's reproductive tract. These cells that line an organ can be the first line of defense against invasion by microorganisms, and the TLRs expressed in epithelial cells can play a crucial role in regulating proliferation and apoptosis.
    [00036] The cancer cell that expresses TLR can be selected from the following table: Table 1 Expression of TLR in Human Cancer cells


    [00037] The TLR expressed in cancer cells can regulate the NF-KB cascade upward and produce anti-apoptotic proteins that contribute to cancer cell carcinogenesis and proliferation.
    [00038] Four TLR adapter molecules are known to be involved in signaling. These proteins are known as myeloid differentiation factor 88 (MyD88), Tirap (also called Mal), Trif, and Tram. Adapters activate other molecules within the cell, including certain protein kinases (IRAK1, IRAK4, TBK1, and IKKi) that amplify the signal, and ultimately lead to the induction or suppression of genes that orchestrate the inflammatory response. TLR signaling trajectories during pathogenesis can induce immune reactions, via extracellular and intracellular trajectories measured by MyD88, activated B cell kappa factor (NF-kB) light chain enhancer, and mitogen-associated kinase protein (MAPK). Altogether, thousands of genes are activated by TLR signaling, and collectively, TLR constitutes one of the most pleiotropic inputs, still tightly regulated for gene modulation.
    [00039] TLRs together with Interleukin-1 receptors form a receptor superfamily, known as the "Interleukin-1 / Toll-like Receptor Superfamily". All members of this family have a so-called TIR domain (Toll-IL-1 receptor). Three subgroups of TIR domains can exist. Proteins with a subgroup of I TIR domains are receptors for interleukins that are produced by macrophages, monocytes and dendritic cells and all domains of extracellular immunoglobulin (Ig). Proteins with a subgroup of II TIR domains are classic TLRs, and they bind directly or indirectly to molecules of microbial origin. A third subgroup of proteins containing TIR (III) domains consists of adapter proteins that are exclusively cytosolic and mediated that signal proteins from subgroups 1 and 2. The TLR can be a fragment, variant, analog, homologous or derivative that it retains or a subgroup of domain I TIR, subgroup of domain II TIR, or subgroup of domain III TIR.
    [00040] TLR can function as a dimer. For example, although many TLRs appear to function as homodimers, TLR2 forms heterodimers with either TLR1 or TLR6, each dimer having a different ligand specificity. TLR may also depend on other co-receptors for total ligand sensitivity, such as in the case of recognition of TLR4's from LPS, which require MD-2. CD14 and LPS Binding Proteins (LBP) are known to facilitate the presentation of LPS to MD-2. The. TLR1
    [00041] The TLR can be TLR1, which recognizes PAMPs with a specificity for gram-positive bacteria. TLR1 was also designated as CD281. B. TLR5
    [00042] TLR can be a toll-like receptor 5. The protein encoded by TLR-5 can play a key role in the recognition and activation of innate immunity pathogens. TLR-5 can recognize PAMPs that are expressed in infectious agents, and mediates the production of cytokines necessary for the development of effective immunity. TLR-5 can recognize bacterial flagellin, a major component of bacterial flagellum and a virulence factor. Activation of TLR can mobilize the nuclear factor NF-KB and stimulate the production of tumor necrosis alpha factor. 3. Toll-like receptor agonist
    [00043] Also provided here is a TLR agonist. The TLR agonist can be a PAMP, which can be a conserved molecular product derived from a pathogen. The pathogenesis can be a gram-positive bacterium, a gram-negative bacterium, fungi, or a virus. The TLR agonist may be a damage-associated molecular model ligand (DAMP), which may be an endogenous molecule released from damaged cells or with dye. A DAMP or PAMP can initiate an immune response through TLR signals and recruit adapter molecules within the cell cytoplasm in order to propagate a signal. The TLR agonist can be an agonist for TLR, which can be a ligand from the following Table 2: Table 2. TLRs and Ligands


    [00044] The TLR agonist can be a fragment, variant, analog, homology or derivative of a PAMP or DAMP that binds to a TLR and induces TLR-mediated activity, such as activation of NF-KB activity. The TLR agonist fragment, variant, analogue, homolog or derivative can be at least 30-99% identical to the amino acids of a TLR agonist and induce TLR-mediated activity. The TLR agonist can target a TLR such as TLR-5. The TLR agonist can be a TLR-5 agonist and stimulates TLR-5 activity. The TLR agonist can be an anti-TLR5 antibody or other small molecule. The TLR agonist may be flagellin.
    [00045] Flagellin may also be a flagellin or flagellin-related polypeptide. Flagellin can be from any source, including a variety of Gram-positive and Gram-negative bacterial species. Flagellin can be a flagellin polypeptide of any Gram-positive or Gram-negative bacterial species including, but not limited to, a flagellin polypeptide disclosed in United States Patent Publication No. 2003/000044429. For example, flagellin may have an amino acid sequence from a bacterial species represented in Figure 7 of United States Patent Publication No. 2003/0044429. The nucleotide sequences encoding the flagellin polypeptides listed in Figure 7 of United States Patent Publication 2003/0044429 are publicly available from sources including the NCBI Gene Bank database. Flagellin may also be a flagellin peptide corresponding to an Accession Number listed in the BLAST results shown in figure 25 of United States Patent Publication 2003/000044429, or a variant thereof. Flagellin may also be a flagellin polypeptide as disclosed in United States Patent Publication No. 2009/0011982. The flagellin can be any one of a flagellin polypeptide as disclosed in figures 6 and 7 here.
    [00046] Flagellin can be a fragment, variant, analog, homology or derived from a flagellin that binds to TLR5 and induces TLR5-mediated activity, such as activation of NF-KB activity. A fragment, variant, analog, homolog, or flagellin derivative can be at least 30-99% identical to the amino acids of a flagellin that binds to TLR5 and induces TLR5-mediated activity.
    [00047] The flagellin may be of a Salmonella species, a representative example of which is S.dublin (encoded by the Accession Number in the Gene Bank M84972). The flagellin-related polypeptide can be a fragment, variant, analog, homolog, or derivative of M84972, or a combination thereof, which binds to TLR5 and induces TLR5-mediated activity, such as activation of NF-kB activity. A fragment, variant, analogue, homologous, or flagellin derivative can be obtained by design based on the rational structure of the Flagellin domain and the conserved structure recognized by TLR5.
    [00048] Flagellin can comprise at least 10, 11, 12, or 13 of the 13 conserved amino acids shown in figure 5 (positions 89, 90, 91, 95, 98, 101, 115, 422, 423, 426, 431, 436 and 452). Flagellin can be at least 30-99% identical to amino acids 11 174 and 418 505 of M84972. Figure 26 of United States Patent Publication No. 2009/0011982 lists the percentage identity of the amino- and carboxy-terminal flagellin with known TLR-5 that stimulates activity, as compared to M84972.
    [00049] Flagellin may be the major component of bacterial flagellin. Flagellin can be composed of three domains (figure 4). Domain 1 (D1) and domain 2 (D2) can be discontinuous, and can be formed when residues at the terminal amino and terminal carboxy are juxtaposed by the formation of a hairpin structure. The amino and terminal carboxy comprising the D1 and D2 domains can be more conserved, so the medium hypervariable domain (D3) can be highly variable. Studies with a recombinant protein containing the amino D1 and D2 and carboxyl D1 and D2 separated by an Escherichia coli joint (ND1-2 / ECH / CD2) indicate that D1 and D2 can be bioactive when coupled to an ECH element. This chimera, but not the joint alone, can induce degradation of IkBa, activation of NF-kB, and production of NO and IL-8 in two intestinal epithelial cell lines. The non-conserved D3 domain may be on the surface of the flagellar filament, and may contain the largest antigenic epitopes. The potent pro-inflammatory activity of flagellin may reside in the highly conserved regions N and C D1 and D2 (See figure 4).
    [00050] Flagellin can induce NF-kB activity by binding to a toll-like receptor 5 (TLR5). The TLR can recognize a conserved structure that is particular to flagellin. The conserved structure can be composed of a large group of residues that are somewhat permissive to variation in amino acid content. Smith et al., Nat Immunol. 4: 1247-53 (2003), the contents of which are incorporated herein by reference, identified 13 amino acids conserved in flagellin that are part of the conserved structure recognized by TLR5. The 13 conserved flagellin amino acids that may be important for TLR5 activity are shown in figure 5.
    [00051] Numerous flagellin-canceling mutants have been produced that retain at least some TLR5 that stimulates activity. The flagellin can be such as an annulment mutant, and can be an annulment mutant disclosed in the Examples here. The flagellin may comprise a translated sequence of Accession Number in Gene Bank D13689 missing amino acids 185-306 or 444-492, or Accession Number in Gene Bank M84973 missing amino acids 179-415, or a variant thereof.
    [00052] Flagellin may comprise transposon insertions and changes in the D3 variable domain. The D3 domain can be replaced in part, or in whole, with an articulation or articulating polypeptide that allows the D1 and D2 domains to fold correctly such that the variant stimulates TLR5 activity. The variant articulation elements can be found in E.coli MukB protein, and can have a sequence placed in SEQ ID NOS: 3 and 4, or a variant of these.
    [00053] Flagellin, as described above, can additionally comprise a conductive sequence. The flagellin additionally comprising a conductive sequence can be CBLB502S. 4. Agent
    [00054] This invention also relates to an agent comprising a therapeutically effective amount of a TLR and TLR agonist. The agent can deliver TLR separately from the TLR agonist. The agent can be a vector. The vector can comprise a first nucleic acid encoding the TLR and a second nucleic acid comprising the TLR agonist. The vector may be able to transduce mammalian cells. The vector may be capable of bicistronic expression of the TLR and / or TLR agonist using strong promoters. The vector can comprise only one gene encoding the TLR, which can be controlled by a strong promoter. The vector can be distributed in a mammalian cell by a virus or liposome-related vector system. The virus vector system can be an adenovirus or cytomegalovirus.
    [00055] The agent can be a liposome that houses the vector. The liposome may be able to transduce mammalian cells and distribute the vector for expression.
    [00056] The agent can be a drug formulation that simultaneously induces expression and activates TLR, thereby exposing the tumor or infected cells to the host's immune system that mimics the situation of massive penetration through the intestinal wall. The agent can be a drug formulation that expresses TLR in combination with the TLR agonist, and can be delivered systematically in solution for administration such as intramuscularly. The agent can be a drug formulation that expresses TLR in combination with the TLR agonist, which can be expressed from the same vector, such as an adenoviral or cytomegalovirus vector system. The agent can be a drug formulation that expresses the TLR in combination with the TLR agonist expressed in the form of a nano-particle, which can drive a functional agonist to the cell surface of a mammalian cell.
    [00057] The agent can be a pharmaceutical agent comprising the drug formulation described above, which can be produced using methods well known in the art. The agent can also comprise a coagent.
    [00058] The vector can comprise a first nucleic acid encoding TLR5 and a second nucleic acid comprising flagellin. The vector may be able to express TLR5 and / or flagellin using a strong promoter. The expression vector may additionally comprise a conductive sequence cloned upstream of the gene encoding TLR or TLR5 and / or flagellin. The expression vector can be a vector system based on pCD515. The expression vector can be pCD515-CMV-hTLR5-EF1-502 as described in figure 1A. The expression vector can be pCD515-CMV-hTLR5 as described in figure 1B. The expression vector can be pCD515-CMV-Sseap-502 as described in figure 1C.
    [00059] The agent can be a drug formulation that simultaneously induces expression and activates a TLR, thereby exposing tumor or infected cells to the host's immune system that mimics the situation of massive penetration through the intestinal wall. The drug formulation can be in the form of a viral expression system that houses the vector. The drug formulation can be a functional human TLR5 expression adenovirus in combination with:
    [00060] the TLR agonist, distributed systemically in the solution for administration, such as intramuscularly;
    [00061] the TLR agonist, expressed from the same adenoviral vector as the TLR; or
    [00062] the TLR agonist, expressed in the form of nano-particles leading to the TLR agonist, such as flagellin, which can be derived from CBLB502, on its surface. The nano-particle can be based on a T7 bacteriophage, or fully formed to retain its biological activity. The nano-formulation can provide dose-dependent NF-KB-responsive reporter activation, and can result in cell internalization by endocytosis for an effective immunization approach (Mobian AP-A). The. Management
    [00063] The administration of the agents using the method described herein can be orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, or combinations thereof. Parenteral administration includes, but is not limited to, intravenous, intrarterial, intraperitoneal, subcutaneous, intramuscular, intrathecal, and intrarticular. For veterinary use, the agent can be administered as a suitably acceptable formulation in accordance with normal veterinary practice. The veterinarian can readily determine the dosage regimen and route of administration that is most appropriate for a particular animal. The agents can be administered to a human patient, cat, dog, large animal, or bird.
    [00064] The agent can be administered simultaneously or metronomically with other treatments. The term "simultaneous" or "simultaneously", as used herein, means that the agent and other treatment to be administered within 48 hours, preferably 24 hours, more preferably 12 hours, even more preferably 6 hours, and, more preferably, 3 hours or less between each other. The term "metronomically", as used herein, means administration of the agent at different times than the other treatment, and at a certain frequency relative to repeated administration.
    [00065] The agent can be administered at any point before the other treatment including about 120 hours, 118 hours, 116 hours, 114 hours, 112 hours, 110 hours, 108 hours, 106 hours, 104 hours, 102 hours, 100 hours , 98 hours, 96 hours, 94 hours, 92 hours, 90 hours, 88 hours, 86 hours, 84 hours, 82 hours, 80 hours, 78 hours, 76 hours, 74 hours, 72 hours, 70 hours, 68 hours, 66 hours, 64 hours, 62 hours, 60 hours, 58 hours, 56 hours, 54 hours, 52 hours, 50hr, 48 hours, 46 hours, 44 hours, 42 hours, 40 hours, 38 hours, 36 hours, 34 hours, 32 hours, 30 hours, 28 hours, 26 hours, 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 3 hours, 2 hours, 1 hour, 55 minutes, 50 minutes, 45 minutes, 40 minutes, 35 minutes, 30 minutes, 25 minutes, 20 minutes, 15 minutes, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes , 3 minutes, 2 minutes, and 1 minutes. The agent can be administered at any point before a second treatment of the agent including about 120 hours, 118 hours, 116 hours, 114 hours, 112 hours, 110 hours, 108 hours, 106 hours, 104 hours, 102 hours, 100 hours , 98 hours, 96 hours, 94 hours, 92 hours, 90 hours, 88 hours, 86 hours, 84 hours, 82 hours, 80 hours, 78 hours, 76 hours, 74 hours, 72 hours, 70 hours, 68 hours, 66 hours, 64 hours, 62 hours, 60 hours, 58 hours, 56 hours, 54 hours, 52 hours, 50hr, 48 hours, 46 hours, 44 hours, 42 hours, 40 hours, 38 hours, 36 hours, 34 hours, 32 hours, 30 hours, 28 hours, 26 hours, 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 3 hours, 2 hours, 1 hour, 55 minutes, 50 minutes, 45 minutes, 40 minutes, 35 minutes, 30 minutes, 25 minutes, 20 minutes, 15 minutes, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes , 3 minutes, 2 minutes, and 1 minute.
    [00066] The agent can be administered at any point after another treatment including about 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 14 hours , 16 hours, 18 hours, 20 hours, 22 hours, 24 hours, 26 hours, 28 hours, 30 hours, 32 hours, 34 hours, 36 hours, 38 hours, 40 hours, 42 hours, 44 hours, 46 hours, 48 hours, 50 hours, 52 hours, 54 hours, 56 hours, 58 hours, 60 hours, 62 hours, 64 hours, 66 hours, 68 hours, 70 hours, 72 hours, 74 hours, 76 hours, 78 hours, 80 hours, 82 hours, 84 hours, 86 hours, 88 hours, 90 hours, 92 hours, 94 hours, 96 hours, 98 hours, 100 hours, 102 hours, 104 hours, 106 hours, 108 hours, 110 hours, 112 hours, 114 hours , 116 hours, 118 hours, and 120 hours. The agent can be administered at any point after a second treatment of the agent including about 120 hours, 118 hours, 116 hours, 114 hours, 112 hours, 110 hours, 108 hours, 106 hours, 104 hours, 102 hours, 100 hours, 98 hours, 96 hours, 94 hours, 92 hours, 90 hours, 88 hours, 86 hours, 84 hours, 82 hours, 80 hours, 78 hours, 76 hours, 74 hours, 72 hours, 70 hours, 68 hours, 66 hours , 64 hours, 62 hours, 60 hours, 58 hours, 56 hours, 54 hours, 52 hours, 50hr, 48 hours, 46 hours, 44 hours, 42 hours, 40 hours, 38 hours, 36 hours, 34 hours, 32 hours , 30 hours, 28 hours, 26 hours, 24 hours, 22 hours, 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 3 hours, 2 hours, 1 hour, 55 minutes, 50 minutes, 45 minutes, 40 minutes, 35 minutes, 30 minutes, 25 minutes, 20 minutes, 15 minutes, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes, and 1 minute. B. Formulation
    [00067] The method may comprise administering the agent. Agents provided herein may be in the form of tablets or pills formulated in a conventional manner. For example, tablets and capsules for oral administration may contain conventional excipients, they may be binding agents, fillers, lubricants, disintegrants and wetting agents. Binders include, but are not limited to, syrup, acacia, gelatin, sorbitol, tragacanth, starch mucilage and polyvinylpyrrolidone. The fillers can be lactose, sugar, microcrystalline cellulose, corn starch, calcium phosphate, and sorbitol. Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica. Disintegrants can be potato starch and sodium starch glycolate. The wetting agents can be sodium lauryl sulfate. The tablets can be coated according to methods well known in the art.
    [00068] The agents provided herein may also be liquid formulations, such as aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs. The agents can also be formulated as a dry product for constitution with water or another suitable vehicle before use. Such liquid preparations can contain additives such as suspending agents, emulsifying agents, non-aqueous vehicles and preservatives. The suspending agent can be sorbitol syrup, methyl cellulose, glucose / sugar syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gel, and hydrogenated edible fats. Emulsifying agents can be lecithin, sorbitan monooleate, and acacia. Non-aqueous vehicles can be edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol. The preservatives can be methyl or propyl p-hydroxybenzoate and sorbic acid.
    [00069] The agents provided herein may also be formulated as suppositories, which may contain suppository bases such as cocoa butter or glycerides. The agents provided herein can also be formulated for inhalation, which can be in the form of a solution, suspension or emulsion which can be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifluoromethane or trichlorofluoromethane. The agents provided herein can also be formulated as transdermal formulations comprising aqueous or non-aqueous vehicles such as creams, ointments, lotions, pastes, medicated plaster, plaster or membrane.
    [00070] The agents provided herein may also be formulated for parenteral administration, such as by injection, intratumor injection or continuous infusion. Injection formulations may be in the form of suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing and dispersing agents. The agent can also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free, water.
    [00071] The agents provided herein can also be formulated as a depot preparation, which can be administered by implantation or by intramuscular injection. The agents can be formulated with suitable hydrophobic or polymeric materials (such as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives (such as a sparingly soluble salt, for example). ç. Dosage
    [00072] The method may comprise administering a therapeutically effective amount of the agent to a patient in need thereof. The therapeutically effective amount required for use in therapy varies with the nature of the condition being treated, the length of time desired to activate TLRy activity, and the patient's age / condition. In general, however, doses used for the treatment of human adults are in the range of 0.001 mg / kg to about 200 mg / kg per day. The dose can be about 1 mg / kg to about 100 mg / kg per day. The desired dose can be conveniently administered in a single dose, or as multiple doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. Multiple doses may be desired, or required.
    [00073] The dosage can be at any dosage such as about 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0 , 6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 25 mg / kg, 50 mg / kg, 75 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 225 mg / kg, 250 mg / kg, 275 mg / kg, 300 mg / kg, 325 mg / kg, 350 mg / kg, 375 mg / kg, 400 mg / kg, 425 mg / kg, 450 mg / kg, 475 mg / kg, 500 mg / kg, 525 mg / kg, 550 mg / kg, 575 mg / kg, 600 mg / kg, 625 mg / kg, 650 mg / kg, 675 mg / kg, 700 mg / kg, 725 mg / kg, 750 mg / kg, 775 mg / kg, 800 mg / kg, 825 mg / kg, 850 mg / kg, 875 mg / kg, 900 mg / kg, 925 mg / kg, 950 mg / kg, 975 mg / kg or 1 mg / kg. 5. Method for treating cancer
    [00074] Provided here is a vector and agent for use in the treatment of cancer by administration to a mammal in need of this agent. They can also be used for cancer immunotherapy by converting tumor cells into a responsive TLR agonist state with TLR target intratumor stimulation, thereby focusing on an immune response in the tumor. Primary tumors can be treated before surgical removal to reduce the risk of developing metastasis, as well as to treat other tumor nodules. The method may comprise intratumor injection. The agent can be injected into a primary tumor prior to surgical removal to reduce the risk of developing metastasis, as well as to treat other tumor nodules. Any tumor that is accessible to the intravenous injection of adenovirus can be treated.
    [00075] A variety of cancers can be treated according to this invention, including carcinoma, bladder cancer (including accelerated and metastatic bladder cancer), breast, colon (including colorectal cancer), kidney, liver, lung (including lung cancer small and not small cell, and lung adenocarcinoma), ovary, prostate, tests, genitourinary tract, lymphatic system, rectum, larynx, pancreas (including pancreatic exocrine carcinoma), esophagus, stomach, bladder, cervix, thyroid, and skin (including squamous cell carcinoma); hematopoietic tumors of lymphoid lineage including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B cell lymphoma, T cell lymphoma, Hodgkins lymphoma, non-Hodgkins lymphoma, hair cell lymphoma, histiocytic lymphoma, and Burkett lymphoma; hematopoietic tumors of myeloid lineage including acute and chronic myelogenous leukemia, myelodysplastic syndrome, myeloid leukemia, and promyelocytic leukemia; tumors of the central and peripheral nervous system including astrocytoma, neuroblastoma, glioma, and schwannomas; tumors of mesenchymal origin including fibrosarcoma, rhabdomyoscarcoma, and osteosarcoma; and other tumors including melanoma, xenoderma pigmentosum, keratoactantoma, seminoma, follicular thyroid cancer, teratocarcinoma, and cancers of the gastrointestinal tract or abdominopelvic cavity.
    [00076] The method can be combined with other methods for treating cancer, including the use of an immunostimulant, cytokine, or chemotherapeutic. The immunostimulant can be a growth hormone, prolactin or vitamin D. 6. Treatment of infected cells
    [00077] Provided here is a vector and an agent for use in the treatment of an infectious disease by the simultaneous distribution of cells transduced by the agent. They can be used to treat a viral, bacterial, protozoan or fungal parasite infection. Any infectious disease can be treated by them through the use of intracellular injection resulting in autocrine activation of TLR that signals infected cells with minimal systemic effect and, thus, enabling them to attract specific innate immune response to the infected cells. Treatment can be combined with other therapies to treat viral, bacterial, protozoan parasite or fungal infections.
    [00078] Treatment may comprise administering the agent. The treatment may comprise administration of a vaccine comprising the agent, and may be used in combination with any other vaccination, which may comprise a construct that expresses an antigen of choice. EXAMPLE 1 Synthesis of TLR5 / flagellin bicistronic expression vector and Treatment of Tumor Cells
    [00079] Vector constructs were created to express toll-like receptor 5 (TLR-5) and CBLB502 flagellin. The Vector pCD515 was used as a support for these constructs. The human TLR-5 cDNA sequence and the DNA encoding the CBLB502 toll-receptor agonist were individually fused with alkaline phosphatase-derived conductive peptide that enables the targeting of the expressed protein through the endoplasmic reticulum (ER) and Golgi for secretion extracellular.
    [00080] The vector construct pCD515-CMV-hTLR5-EF1-502s expresses the secreted form of CBLB502 flagellin (CBLB502S) and the toll-like receptor 5 (TLR5) on the cell surface. This adenoviral vector requires modification of CBLB502 to achieve its effective synthesis and secretion by the mammalian cell. The adenovirus construct comprises the conductive nucleic acid sequence (Atgctgctgctgctgctgctgctgggcctgaggctacagctctccctgggc) derived from alkaline phosphatase and was cloned upstream of the truncated Salmonella flagellina (fliC) gene (see Burdelya et al. secretable form of flagellin (i.e. CBLB502S). An EF1 promoter (elongation factor 1α) has been cloned upstream of this cassette encoding CBLB502S. The TLR5 gene was derived from human and has the amino acid sequence as shown in figure 9. A CMV promoter has been cloned upstream of the TLR5 gene, this construct coexpresses TLR5 and CBLB502S This construct is shown in Figure 1A.
    [00081] The expression vector pCD515-CMV-hTLR5 was constructed to express the form of human TLR-5 (see figure 9). The adenovirus construct comprises a strong CMV promoter cloned upstream of the hTLR5 cassette. This construct is shown in figure 1B.
    [00082] The expression vector pCD515-CMV-Sseap-502 was constructed to express the secreted flagellin CBLB502 and the toll type. The adenovirus construct comprises a strong CMV promoter cloned upstream of the SEAP 502 flagellin (fliC) conductor sequence gene. This construct is shown in figure 1C. [Need cloning information] EXAMPLE 2 Synthesis of TLR5 / flagellin bicistronic expression vector and Tumor Cell Treatment
    [00083] Two mammalian reporter cell lines, both expressing NF-kB-responsive GFP and differing in their TLR5 status, were transduced with vector constructs pCD515, pCD515-CMV-hTLR5-EF1-502s, pCD515-CMV-hTLR5 -502, pCD515-CMV-hTLR5, and pCD515-CMV-Sseap-502 (see Table 3 below). Table 3 Activity of adenoviral constructs as activators of TLR5 signaling


    [00084] Vector coexpressing TLR5 and TLR5 agonist CBLB502S was sufficient to induce expression of reporter NF-kB in 293 null cells that do not express any known TLRs and that cannot be activated by TLR5 agonist alone. This experiment demonstrates that TLR5 and CBLB502S flagellin can operate in trans or cis to activate TLR5 signaling. EXAMPLE 3
    [00085] To test anti-tumor effects of bicistronic adenovirus having (pCD515-CMV-hTLR5-EF1-502s), 10 ml of the adenoviral suspension (1012-1011 IU / ml) were injected into one of two sc syngeneic growth tumors in Balb mice / c that CT26 mouse colon carcinoma cells originate when tumors reach 3-5 mm in diameter, and the size of the tumor was monitored until the control of uninjected tumors reached the size limit that requires termination of the experiment. Control mice were injected (again, one tumor out of two per mouse) with an adenoviral vector that expresses red fluorescent protein (RFP). The results of a representative experiment are shown in figure 4. Almost complete lack of growth of tumors injected with (pCD515-CMV-hTLR5-EF1-502s) was accompanied with reduced growth of the uninjected tumor within the same animal as compared to the tumors in control animals injected with adenovirus that expresses RFP. This result indicates (i) powerful effect on cis and (ii) visible effect on trans of pCD515-CMV-hTLR5- EF1-502s indicative of recruitment of both innate immune response (cis effect) and adaptive (trans effect). None of the other control viruses listed in Table 1 (i.e., AD5 (control) and Ad5 (TLR5)) injected alone had suppressive growth effects on tumors.
    [00086] Thus, ectopic expression imposed from TLR5 produces tumor cell types, which were originally TLR5 deficient, highly responsive to TLR5 stimulation resulting in the breakdown of tumor immune tolerance, powerful attraction of innate immune response that promotes effective development of adaptive immune response with subsequent general antitumor effect.
    权利要求:
    Claims (1)
    [0001]
    1. Vector, characterized by the fact that it comprises a first and a second nucleic acid, in which the first nucleic acid encodes the amino acid sequence of a human TLR-5 as shown in SEQ ID NO: 99 and the second nucleic acid encodes an agonist of the toll-like receptor selected from flagellin, secreted form of flagellin, in which the second nucleic acid comprises nucleic acid sequences of SEQ ID NO: 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27 , 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55; where the vector is an adenoviral expression vector.
    类似技术:
    公开号 | 公开日 | 专利标题
    BR112012011331B1|2021-03-02|vector comprising nucleic acids encoding a toll-like receptor and an agonist of the same
    US10265390B2|2019-04-23|Use of toll-like receptor agonist for treating cancer
    RU2682762C2|2019-03-21|Improved vector expressing toll-like receptor and agonist, and use in cancer therapy
    BR112019013215A2|2019-12-10|oncolytic virus, pharmaceutical composition, manufacturing product, method for treating cancer and use
    US5972899A|1999-10-26|Apoptosis induced by Shigella IpaB
    US8802837B2|2014-08-12|Nucleic acids molecule encoding the polypeptide for treating virus-induced cancer
    TW201729829A|2017-09-01|Pharmaceutical composition for the prevention or treatment of human papillomavirus-related diseases comprising immunoglobulin Fc-fused interleukin-7
    AU2010228168B2|2013-02-21|DNA vaccine for Alzheimer's disease
    MXPA02003986A|2003-11-07|Chimeric immunogenic compositions and nucleic acids encoding them
    同族专利:
    公开号 | 公开日
    CN104136614B|2018-04-06|
    HK1199058A1|2015-06-19|
    JP2013506437A|2013-02-28|
    EP2486134A1|2012-08-15|
    AU2010303464A1|2012-04-12|
    ES2457518T3|2014-04-28|
    CA2777198C|2018-07-24|
    IL219060D0|2012-06-28|
    JP2015165821A|2015-09-24|
    CA2777198A1|2011-04-14|
    BR112012011331B8|2021-05-25|
    ZA201202500B|2013-06-26|
    IL219060A|2017-02-28|
    MX2012004095A|2012-09-12|
    EP2486134A4|2013-02-13|
    MY163110A|2017-08-15|
    BR112012011331A2|2015-09-15|
    US20120208871A1|2012-08-16|
    US9205095B2|2015-12-08|
    AU2010303464B2|2014-05-01|
    WO2011044246A1|2011-04-14|
    CN104136614A|2014-11-05|
    AP2012006253A0|2012-06-30|
    KR20120104177A|2012-09-20|
    EA201290140A1|2012-11-30|
    JP5796014B2|2015-10-21|
    EP2486134B1|2014-01-08|
    EA021842B1|2015-09-30|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US8703146B2|2001-04-20|2014-04-22|Institute For Systems Biology|Toll-like receptor 5 ligands and methods of use|
    US8580321B2|2003-12-02|2013-11-12|The Cleveland Clinic Foundation|Method for reducing the effects of chemotherapy using flagellin related polypeptides|
    EP1838340B1|2004-12-22|2018-04-04|Cleveland Clinic Foundation|Flagellin related polypeptides and uses thereof|
    MY157941A|2005-01-19|2016-08-15|Vaxinnate Corp|Compositions of pathogen-associated molecular patterns and methods of use|EP1838340B1|2004-12-22|2018-04-04|Cleveland Clinic Foundation|Flagellin related polypeptides and uses thereof|
    EA020579B1|2008-08-01|2014-12-30|Кливленд Байолэбс, Инк.|Methods for treating reperfusion tissue injuries|
    CN103476458B|2011-01-10|2017-02-15|克利夫兰生物实验室公司|Use of toll-like receptor agonist for treating cancer|
    WO2014098649A1|2012-12-18|2014-06-26|Obschestvo S Ogranichennoy Otvetstvennostyu "Panacela Labs"|Compositions and methods using toll-like receptor 5 and toll-like receptor agonist|
    WO2015080631A1|2013-11-27|2015-06-04|Obschestvo S Ogranichennoy Otvetstvennost`Yu "Panacela Labs"|Improved expression vector for toll-like receptor and agonist and use for treating cancer|
    KR20170031251A|2014-07-30|2017-03-20|클리브랜드 바이오랩스, 아이엔씨.|Flagellin compositions and uses|
    CA2963909C|2014-10-07|2021-06-15|Cytlimic Inc.|Hsp70-derived peptide, pharmaceutical composition for treating or preventing cancer using same, immunity inducer, and method for producing antigen-presenting cell|
    US10183056B2|2014-10-16|2019-01-22|Cleveland Biolabs, Inc.|Methods and compositions for the treatment of radiation-related disorders|
    EP3269733B1|2015-03-09|2020-06-17|Cytlimic Inc.|Peptide derived from gpc3, pharmaceutical composition for treatment or prevention of cancer using same, immunity inducer, and method for producing antigen-presenting cells|
    EP3281641B1|2015-04-07|2020-12-16|Cytlimic Inc.|Adjuvant for cancer vaccines|
    KR101634380B1|2015-06-23|2016-06-28|한국생산기술연구원|Method for production of TLR5 agonist|
    CN105801709B|2016-04-29|2019-10-08|北京纽莱福生物科技有限公司|CBLB502-Fc fusion protein and preparation method thereof|
    RU2741228C2|2016-11-14|2021-01-22|Общество С Ограниченной Ответственностью "Панацела Лабс"|Anti-tumor effects of a viral vector encoding a toll-like receptor and a toll-like receptor agonist|
    WO2018210279A1|2017-05-16|2018-11-22|科济生物医药（上海）有限公司|Use of toll-like receptor agonist combined with immune effector cell|
    UY37816A|2017-07-20|2019-02-28|Spogen Biotech Inc|BIOACTIVE POLIPEPTIDES TO IMPROVE PROTECTION, GROWTH AND PRODUCTIVITY IN PLANTS|
    EP3841112A1|2018-08-24|2021-06-30|Codiak BioSciences, Inc.|Extracellular vesicles targeting dendritic cells and uses thereof|
    WO2020163370A1|2019-02-04|2020-08-13|Codiak Biosciences, Inc.|Membrane protein scaffolds for exosome engineering|
    WO2021189047A2|2020-03-20|2021-09-23|Codiak Biosciences, Inc.|Extracellular vesicles for therapy|
    WO2020191369A1|2019-03-21|2020-09-24|Codiak Biosciences, Inc.|Process for preparing extracellular vesicles|
    SG11202109702QA|2019-03-21|2021-10-28|Codiak Biosciences Inc|Extracellular vesicles for vaccine delivery|
    EP3941528A1|2019-03-21|2022-01-26|Codiak BioSciences, Inc.|Extracellular vesicle conjugates and uses thereof|
    WO2021003445A1|2019-07-03|2021-01-07|Codiak Biosciences, Inc.|Extracellular vesicles targeting t cells and uses thereof|
    WO2021062317A1|2019-09-25|2021-04-01|Codiak Biosciences, Inc.|Extracellular vesicle compositions|
    WO2021184017A1|2020-03-13|2021-09-16|Codiak Biosciences, Inc.|Extracellular vesicles for treating neurological disorders|
    WO2021237100A1|2020-05-21|2021-11-25|Codiak Biosciences, Inc.|Methods of targeting extracellular vesicles to lung|
    WO2021246666A1|2020-06-04|2021-12-09|가톨릭대학교 산학협력단|Anticancer drug composition comprising as active ingredient tlr5 agonist derived from flagellin|
    WO2021248133A1|2020-06-05|2021-12-09|Codiak Biosciences, Inc.|Anti-transferrin extracellular vesicles|
    法律状态:
    2017-07-18| B25A| Requested transfer of rights approved|Owner name: ROSWELL PARK CANCER INSTITUTE (US) , PANACELA LABS |
    2017-12-12| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |
    2018-02-14| B25K| Entry of change of name and/or headquarter and transfer of application, patent and certificate of addition of invention: republication|Owner name: ROSWELL PARK CANCER INSTITUTE (US) , PANACELA LABS |
    2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|
    2018-06-12| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|
    2018-06-26| B07B| Technical examination (opinion): publication cancelled [chapter 7.2 patent gazette]|
    2019-04-16| B07E| Notice of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|Free format text: NOTIFICACAO DE ANUENCIA RELACIONADA COM O ART 229 DA LPI |
    2019-05-14| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|
    2019-05-21| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|
    2019-09-17| B07A| Technical examination (opinion): publication of technical examination (opinion) [chapter 7.1 patent gazette]|
    2020-08-11| B06A| Notification to applicant to reply to the report for non-patentability or inadequacy of the application [chapter 6.1 patent gazette]|
    2021-01-05| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|
    2021-03-02| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 10 (DEZ) ANOS CONTADOS A PARTIR DE 02/03/2021, OBSERVADAS AS CONDICOES LEGAIS. |
    2021-05-25| B16C| Correction of notification of the grant|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 06/10/2010 OBSERVADAS AS CONDICOES LEGAIS. PATENTE CONCEDIDA CONFORME ADI 5.529/DF |
    优先权:
    申请号 | 申请日 | 专利标题
    US24925309P| true| 2009-10-06|2009-10-06|
    US61/249,253|2009-10-06|
    US24959609P| true| 2009-10-07|2009-10-07|
    US61/249,596|2009-10-07|
    PCT/US2010/051646|WO2011044246A1|2009-10-06|2010-10-06|Use of toll-like receptor and agonist for treating cancer|
    [返回顶部]